Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0082081 | |||
Gene | CADPS2 | Organism | Human |
Genome Locus | chr7:122120905-122377122:- | Build | hg19 |
Disease | Coronary Artery Disease (CAD) | ICD-10 | Atherosclerotic cardiovascular disease, so described (I25) |
DBLink | Link to database | PMID | 28045102 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 2 Coronary Artery Disease (CAD) patients and 12 control individuals |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CTTTGCTGACCTGTAGCTGGTA ReverseCATTGAGGAAGGCCTGGAACC | Statistics | Fold Change : Upregulated,2.083496911 pvalue : p=0.006557032 |
Citation | |||
Zhao, Z, Li, X, Gao, C, Jian, D, Hao, P, Rao, L, Li, M (2017). Peripheral blood circular RNA hsa_circ_0124644 can be used as a diagnostic biomarker of coronary artery disease. Sci Rep, 7:39918. |